View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_high_40 (Length: 357)
Name: NF0829_high_40
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0829_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 103 - 278
Target Start/End: Original strand, 3566951 - 3567127
Alignment:
Q |
103 |
cattatcaaccctcacaaaacatcattct-gacaactaatctcttttgctagatgttcaagttaataacatactttttgcttctcagttcaaattcatga |
201 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3566951 |
cattatcaaccctcacaaaacatcattctagacaactaatctcttttgctagatgttcaagttaataacatactttttgcttctcagttcaaattcatga |
3567050 |
T |
 |
Q |
202 |
gaatgtgggtttctcatcctgattgttccacaattgttagagatagctggagttttaatgtgattggttgccctatg |
278 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
3567051 |
gaatgtgggtttctcatcctgattgttccacaattgttagagatagctggatttttaatgtgattggttgccctatg |
3567127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3151 times since January 2019
Visitors: 6169