View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_high_41 (Length: 353)
Name: NF0829_high_41
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_high_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 6 - 113
Target Start/End: Complemental strand, 12583645 - 12583538
Alignment:
| Q |
6 |
aataatccataactgtttcccttgttatattgatctatgaacttcttgctacatttgtgctattcaaactaaatcatatattcttttgaagattttcttg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12583645 |
aataatccataactgtttcccttgttatattcatctatgaacttcttgctacatttgtgctattcaaactaaatcatatattcttttgaagattttcttg |
12583546 |
T |
|
| Q |
106 |
cacaggtt |
113 |
Q |
| |
|
|||||||| |
|
|
| T |
12583545 |
cacaggtt |
12583538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 275 - 345
Target Start/End: Complemental strand, 4201731 - 4201666
Alignment:
| Q |
275 |
aggtatcatttactcgtctttcgctttgatgtttgtatcatgctctagtgcctcttggctgtgtctgtgct |
345 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
4201731 |
aggtgtcatttacttgtctttcgctttgatgtttgtatcacgctcta-----tcttggctgtgtctgtgct |
4201666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 835 times since January 2019
Visitors: 6131