View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0829_high_6 (Length: 583)

Name: NF0829_high_6
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0829_high_6
NF0829_high_6
[»] chr6 (3 HSPs)
chr6 (17-180)||(17171605-17171766)
chr6 (473-554)||(17172808-17172889)
chr6 (302-464)||(17171977-17172136)


Alignment Details
Target: chr6 (Bit Score: 89; Significance: 1e-42; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 17 - 180
Target Start/End: Original strand, 17171605 - 17171766
Alignment:
17 gagatgaagaaaatgacgtctgattacgaggatatacttctgagcatacgattttacaacggggttggttgcattcaatacgaaggttgccaccttcttt 116  Q
    |||||||||||||||| ||||||||| |||||||  ||||||||||||| || ||||| || ||| ||||||||| |||||||||||| || ||||||||    
17171605 gagatgaagaaaatgaggtctgattatgaggata--cttctgagcataccatcttacagcgaggtaggttgcatttaatacgaaggttaccgccttcttt 17171702  T
117 ttcgcatttggatggttcaaatcaggaggttttggcattgagttatcctgatattgctggacaa 180  Q
     |||||||||||||||| |||| | ||||||||||||||||||||||||| ||||| |||||||    
17171703 gtcgcatttggatggtttaaattaagaggttttggcattgagttatcctggtattgttggacaa 17171766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 473 - 554
Target Start/End: Original strand, 17172808 - 17172889
Alignment:
473 ataaactattgcactctgatttttgaatttggttttgcactcaaatggacttgcaaattctgctctaatctaatatgactat 554  Q
    ||||||| |||||| |||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||    
17172808 ataaacttttgcacactgaattttgaatttggttttgtactcagatggacttgcaaattctgctctaatctaatatggctat 17172889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 302 - 464
Target Start/End: Original strand, 17171977 - 17172136
Alignment:
302 tatgcagatttctagtagactgatactcttatggctatccgtttttcttccttttatatccgtttttctagtatcatccttcaagactctcacaccttag 401  Q
    ||||||| || |||||| |||||||||||||| | |||| || |||  || |||| ||||  ||||  | || |||||||||||||||| | |  | |||    
17171977 tatgcagtttcctagtacactgatactcttatagttatctgtcttttgtcattttgtatctcttttggt-gtttcatccttcaagactcgcgc--catag 17172073  T
402 tagttgctgcttgatcaaagtttgcgacgattacaacaatgaggctaaagcaattgatgattt 464  Q
    |||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
17172074 tagtcgttgcttgatcaaagtttgcgacaattacaacaatgaggctaaagcaattgatgattt 17172136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University