View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_high_60 (Length: 304)
Name: NF0829_high_60
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_high_60 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 46 - 304
Target Start/End: Complemental strand, 46633402 - 46633143
Alignment:
| Q |
46 |
aatttcccttgtgatacttaccaatcttctaagatttttgatattttacatgccgatatttgtggtccttattctaccccttctaagtcttgtcataagt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46633402 |
aatttcccttgtgatacttaccaatcttctaagatttttgatattttacatgccgatatttgtggtccttattctaccccttctaagtcttgtcataagt |
46633303 |
T |
 |
| Q |
146 |
actgtattactctt-gttgatgattttagttgatttacttggataattttgatgaaacaaaaaagtaaaattagaggtcacttggttaattttcgttctt |
244 |
Q |
| |
|
| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46633302 |
attgtattactctttgttgatgattttagttgatttacttggataattttgatgaaacaaaaaagtaaaattagaggtcacttggttaattttcgttctt |
46633203 |
T |
 |
| Q |
245 |
atattgaaacacaattttctagttgattcacttggataatggtgtgaacttttatgcacg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46633202 |
atattgaaacacaattttctagttgattcacttggataatggtgtgaacttttatgcacg |
46633143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University