View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_high_69 (Length: 273)
Name: NF0829_high_69
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_high_69 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 33 - 251
Target Start/End: Complemental strand, 48754658 - 48754440
Alignment:
| Q |
33 |
cagagagataacacaccacaataaacaaatacaaaatgaaatcgagtcaaaatctcgtcagtcccagctgaaatcctgcagctctcaaatttgtacggct |
132 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48754658 |
cagagagacaacacaccacaataaacaaataaaaaatgaaatcgagtcaaaatctcgtcagtcccagctgaaatcctgcagctctcaaatttgtacggct |
48754559 |
T |
 |
| Q |
133 |
agaacaaaatatcccaccctctatttattccttcagggtttcaataagggttacccagcaaattcagatacacaggtattgcaatgaaaatctggattaa |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48754558 |
agaacaaaatatcccaccctctatttattccttcagggtttcaataagggttacccagcaaattcagatacacaggtattgcaatgtaaatctggattaa |
48754459 |
T |
 |
| Q |
233 |
gtttggccaaattaagtaa |
251 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
48754458 |
gtttggccaaattaagtaa |
48754440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 102 - 242
Target Start/End: Complemental strand, 49053265 - 49053124
Alignment:
| Q |
102 |
gaaatcctgcagctctcaaatttgtacggctagaacaaaatatccc-accctctatttattccttcagggtttcaataagggttacccagcaaattcaga |
200 |
Q |
| |
|
|||| ||||||| |||| ||||||||| |||||||||||||||||| ||||||||||| ||||||||| || ||||||||||||||||| |||| ||||| |
|
|
| T |
49053265 |
gaaaccctgcaggtctcgaatttgtacagctagaacaaaatatccccaccctctattttttccttcagagtctcaataagggttacccaacaaactcaga |
49053166 |
T |
 |
| Q |
201 |
tacacaggtattgcaatgaaaatctggattaagtttggccaa |
242 |
Q |
| |
|
||||||||||||||||| || |||| || |||||||||||| |
|
|
| T |
49053165 |
tacacaggtattgcaatcaatttctgaatcaagtttggccaa |
49053124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 94 - 168
Target Start/End: Complemental strand, 29031700 - 29031626
Alignment:
| Q |
94 |
tcccagctgaaatcctgcagctctcaaatttgtacggctagaacaaaatatcccaccctctatttattccttcag |
168 |
Q |
| |
|
|||||| ||||| ||| |||||||| |||||| || |||||||||||||||| |||||||| || ||||||||| |
|
|
| T |
29031700 |
tcccagatgaaaccctacagctctcgaatttggactgctagaacaaaatatctcaccctcttttctttccttcag |
29031626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University