View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_high_78 (Length: 251)
Name: NF0829_high_78
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_high_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 30400621 - 30400772
Alignment:
| Q |
1 |
tgtatgtttgtgaataaattttgctacttggtatggaaatttgttttaaatttttgagggggtaatctgttgttacattctcgtctctatacaattcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30400621 |
tgtatgtttgtgaataaattttgctacttggtatggaaatttgttttaaatttttgagggggtaatctgttgttacattcttgtctctatacaattcata |
30400720 |
T |
|
| Q |
101 |
tacttttaattattgagaataaatcttggatttaggtaagaagaccgttagt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30400721 |
tacttttaattattgagaataaatcttggatttaggtaagaagaccgttagt |
30400772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 911 times since January 2019
Visitors: 6134