View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0829_high_79 (Length: 251)

Name: NF0829_high_79
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0829_high_79
NF0829_high_79
[»] chr3 (2 HSPs)
chr3 (1-159)||(30400487-30400645)
chr3 (41-77)||(30388308-30388344)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 30400645 - 30400487
Alignment:
1 agcaaaatttattcacaaacatacagaagattggtcattaattaagaaatgaaaatgtgaataacagtgttatttattaccgttatatgaatgactcttc 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30400645 agcaaaatttattcacaaacatacacaagattggtcattaattaagaaatgaaaatgtgaataacagtgttatttattaccgttatatgaatgactcttc 30400546  T
101 ctctcagttttgacccttgagctaatgcagccacccatgccagtgtgttattgatgatg 159  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
30400545 ctctcagttttgacccttgagctaatgcagccatccatgccagtgtgttattgatgatg 30400487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 77
Target Start/End: Complemental strand, 30388344 - 30388308
Alignment:
41 attaagaaatgaaaatgtgaataacagtgttatttat 77  Q
    ||||||||| |||||||||||||||| ||||||||||    
30388344 attaagaaaggaaaatgtgaataacaatgttatttat 30388308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University