View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_high_89 (Length: 228)
Name: NF0829_high_89
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_high_89 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 228
Target Start/End: Original strand, 30224743 - 30224952
Alignment:
| Q |
20 |
gcgatcataataaatgtaacaaattcacttaatttttgtgtgaatgatcacatatttcagttggatagggtgtggtgtgtg-tggatttaattttggtag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30224743 |
gcgatcataataaatgtaacaaattcacttaatttttgtgtgaatgatcacatatttcagttggatagggtgtggtgtgtggtggatttaattttggtag |
30224842 |
T |
 |
| Q |
119 |
catgttaattatttttctcttagtagtttgcgttgtcttttactttttattgttttggggccttgaattttgttatgtttcggtccttacaggcgggctt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
30224843 |
catgttaattatttttctcttagtagtttgcattgtcttttactttttattgttgtggggccttgaattttgttatgtttcggtccttaccggcgggttt |
30224942 |
T |
 |
| Q |
219 |
tggtgaagat |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
30224943 |
tggtgaagat |
30224952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University