View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_high_91 (Length: 217)
Name: NF0829_high_91
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0829_high_91 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 22102345 - 22102213
Alignment:
Q |
1 |
gaatgaactagagaagtaattgaatttgacaattgacacagatgtcttaaattaggtataaaaagatgaacttatttagaatatactttaattcaatgca |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
22102345 |
gaatgaactagagaagtaattgaatttgacaattgacacagatgtcttaaattaggtataaaaagatgaacttatttagaatatactttaatttaatgca |
22102246 |
T |
 |
Q |
101 |
tatcaattctcatgtacataaatctggtctctg |
133 |
Q |
|
|
||||||||||||||||||| | ||||||||||| |
|
|
T |
22102245 |
tatcaattctcatgtacattactctggtctctg |
22102213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1679 times since January 2019
Visitors: 6148