View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_100 (Length: 245)
Name: NF0829_low_100
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0829_low_100 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 9145560 - 9145782
Alignment:
Q |
1 |
ttcagcagtgctttgcattcaagctgtgcaagagaatattgaaccaaagagtctaggggacattactttagaagccccttgtaaggttcgatttggtgta |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
9145560 |
ttcagcagtgctttgcattcaagctgtgcaagagaatattgaaccaaagagtctaggggacattactttagaagccccttgtagggttcgatttggtgta |
9145659 |
T |
 |
Q |
101 |
atctccttgtttggtgaattttacattgcagtaataatgttggtcctttgatgtggttgctgcagtattatgtctcctcttgtagagcatgttgctcagt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9145660 |
atctccttgtttggtgaattttacattgcactaataatgttggtcctttgatgtggttgctgcagtattatgtctcctcttgtagagcatgttgctcagt |
9145759 |
T |
 |
Q |
201 |
tgactagttcccaaaggctactt |
223 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
9145760 |
tgactagttcccaaaggctactt |
9145782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University