View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0829_low_105 (Length: 228)

Name: NF0829_low_105
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0829_low_105
NF0829_low_105
[»] chr4 (1 HSPs)
chr4 (20-228)||(30224743-30224952)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 228
Target Start/End: Original strand, 30224743 - 30224952
Alignment:
20 gcgatcataataaatgtaacaaattcacttaatttttgtgtgaatgatcacatatttcagttggatagggtgtggtgtgtg-tggatttaattttggtag 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
30224743 gcgatcataataaatgtaacaaattcacttaatttttgtgtgaatgatcacatatttcagttggatagggtgtggtgtgtggtggatttaattttggtag 30224842  T
119 catgttaattatttttctcttagtagtttgcgttgtcttttactttttattgttttggggccttgaattttgttatgtttcggtccttacaggcgggctt 218  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| ||    
30224843 catgttaattatttttctcttagtagtttgcattgtcttttactttttattgttgtggggccttgaattttgttatgtttcggtccttaccggcgggttt 30224942  T
219 tggtgaagat 228  Q
    ||||||||||    
30224943 tggtgaagat 30224952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University