View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_106 (Length: 222)
Name: NF0829_low_106
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0829_low_106 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 4075284 - 4075390
Alignment:
Q |
1 |
gagacaccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttaaaggctcccattgcttcctatagatagatggatggccttct |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
4075284 |
gagacaccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttagaggctcccattgcttcctatagatagatggatgaccttct |
4075383 |
T |
 |
Q |
101 |
tttctgt |
107 |
Q |
|
|
||||||| |
|
|
T |
4075384 |
tttctgt |
4075390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 5 - 107
Target Start/End: Complemental strand, 25824872 - 25824770
Alignment:
Q |
5 |
caccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttaaaggctcccattgcttcctatagatagatggatggccttcttttc |
104 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||| || |||| |||| ||| ||||| || |||||||||||||| || || |||||||||| |
|
|
T |
25824872 |
caccaatgtatgcaatctgcataaccatttggatttgatatctgttcttgagttagaggttcccactgtttcctatagatagaagggtgaccttcttttc |
25824773 |
T |
 |
Q |
105 |
tgt |
107 |
Q |
|
|
||| |
|
|
T |
25824772 |
tgt |
25824770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University