View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0829_low_106 (Length: 222)

Name: NF0829_low_106
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0829_low_106
NF0829_low_106
[»] chr4 (1 HSPs)
chr4 (1-107)||(4075284-4075390)
[»] chr7 (1 HSPs)
chr7 (5-107)||(25824770-25824872)


Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 4075284 - 4075390
Alignment:
1 gagacaccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttaaaggctcccattgcttcctatagatagatggatggccttct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||    
4075284 gagacaccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttagaggctcccattgcttcctatagatagatggatgaccttct 4075383  T
101 tttctgt 107  Q
    |||||||    
4075384 tttctgt 4075390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 5 - 107
Target Start/End: Complemental strand, 25824872 - 25824770
Alignment:
5 caccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttaaaggctcccattgcttcctatagatagatggatggccttcttttc 104  Q
    ||||||||||||||||||||||||   |||||||||||||| || ||||  |||| ||| ||||| || |||||||||||||| || || ||||||||||    
25824872 caccaatgtatgcaatctgcataaccatttggatttgatatctgttcttgagttagaggttcccactgtttcctatagatagaagggtgaccttcttttc 25824773  T
105 tgt 107  Q
    |||    
25824772 tgt 25824770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University