View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0829_low_108 (Length: 217)

Name: NF0829_low_108
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0829_low_108
NF0829_low_108
[»] chr6 (1 HSPs)
chr6 (9-142)||(21145059-21145192)


Alignment Details
Target: chr6 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 9 - 142
Target Start/End: Complemental strand, 21145192 - 21145059
Alignment:
9 tcttgccttcatacaattatggaaaaagttggtgttagaatccccttttttaagccacttgatacgagatctttgcaccaccaatgaatcttttgcttta 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
21145192 tcttgccttcatacaattatggaaaaagttggtgttagaatccccttctttaagccacttgatacgagatctttgcaccaccaatgaatcttttgcttta 21145093  T
109 agaagactccataaagcacaaattttttcttttc 142  Q
    ||||||||||||||||||||||  ||||||||||    
21145092 agaagactccataaagcacaaaaattttcttttc 21145059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 624 times since January 2019
Visitors: 6130