View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_108 (Length: 217)
Name: NF0829_low_108
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_108 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 9 - 142
Target Start/End: Complemental strand, 21145192 - 21145059
Alignment:
| Q |
9 |
tcttgccttcatacaattatggaaaaagttggtgttagaatccccttttttaagccacttgatacgagatctttgcaccaccaatgaatcttttgcttta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21145192 |
tcttgccttcatacaattatggaaaaagttggtgttagaatccccttctttaagccacttgatacgagatctttgcaccaccaatgaatcttttgcttta |
21145093 |
T |
 |
| Q |
109 |
agaagactccataaagcacaaattttttcttttc |
142 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
21145092 |
agaagactccataaagcacaaaaattttcttttc |
21145059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University