View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_110 (Length: 216)
Name: NF0829_low_110
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_110 |
 | |
|
| [»] scaffold0428 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 31564985 - 31564907
Alignment:
| Q |
1 |
cgtcttccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttcatgcaagtgttggt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31564985 |
cgtcttccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttcatgtaagtgttggt |
31564907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 2 - 66
Target Start/End: Original strand, 33414724 - 33414788
Alignment:
| Q |
2 |
gtcttccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttca |
66 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
33414724 |
gtcttccggatttcttatcagcggatgagagaccctttttcctgagatatgcttgcgccttttca |
33414788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 2 - 66
Target Start/End: Original strand, 33293130 - 33293194
Alignment:
| Q |
2 |
gtcttccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttca |
66 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
33293130 |
gtcttctggatttcttatcagcgaatgagagacccttttttctgaggtatgctttcaccttttca |
33293194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 33279079 - 33279139
Alignment:
| Q |
7 |
ccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttcatg |
68 |
Q |
| |
|
||||||||||||||||| ||| |||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
33279079 |
ccggatttcttgtcagctgataagagaccc-tttttctaaggtatgcttgcgccttttcatg |
33279139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 2 - 66
Target Start/End: Original strand, 33258352 - 33258416
Alignment:
| Q |
2 |
gtcttccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttca |
66 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
33258352 |
gtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttca |
33258416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 33395215 - 33395274
Alignment:
| Q |
7 |
ccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttca |
66 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| ||||||| ||| ||||||||| |
|
|
| T |
33395215 |
ccggatttcttgtcagctgatgagagaccctttgttctaaggtatgattgggccttttca |
33395274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 28873091 - 28873045
Alignment:
| Q |
20 |
cagcggatgagagacccttttttctgaggtatgcttgcgccttttca |
66 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
28873091 |
cagcagatgagagacccttttatctgaggtatgcttacgccttttca |
28873045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 2 - 66
Target Start/End: Complemental strand, 17447825 - 17447760
Alignment:
| Q |
2 |
gtcttccggatttcttgtcagcggatgagagaccc-ttttttctgaggtatgcttgcgccttttca |
66 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17447825 |
gtcttccggatttcttatcagcggatgagagaccccttttttctgaggtatgcttgcgccttttca |
17447760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0428 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0428
Description:
Target: scaffold0428; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 15174 - 15114
Alignment:
| Q |
7 |
ccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttcatg |
68 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
15174 |
ccggatttcttgtcagctgataagagacccttttt-ctaaggtatgcttgcgccttttcatg |
15114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0428; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 2 - 66
Target Start/End: Original strand, 2473 - 2537
Alignment:
| Q |
2 |
gtcttccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttca |
66 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
2473 |
gtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttca |
2537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1549 times since January 2019
Visitors: 6145