View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_114 (Length: 207)
Name: NF0829_low_114
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_114 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 3567127 - 3566951
Alignment:
| Q |
15 |
catagggcaaccaatcacattaaaactccagctatctctaacaattgtggaacaatcaggatgagaaacccacattctcatgaatttgaactgagaagca |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3567127 |
catagggcaaccaatcacattaaaaatccagctatctctaacaattgtggaacaatcaggatgagaaacccacattctcatgaatttgaactgagaagca |
3567028 |
T |
|
| Q |
115 |
aaaagtatgttattaacttgaacatctagcaaaagagattagttgtc-agaatgatgttttgtgagggttgataatg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3567027 |
aaaagtatgttattaacttgaacatctagcaaaagagattagttgtctagaatgatgttttgtgagggttgataatg |
3566951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 382 times since January 2019
Visitors: 6128