View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_116 (Length: 201)
Name: NF0829_low_116
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_116 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 15 - 184
Target Start/End: Original strand, 22102213 - 22102382
Alignment:
| Q |
15 |
cagagaccagatttatgtacatgagaattgatatgcattgaattaaagtatattctaaataagttcatctttttatacctaatttaagacatctgtgtca |
114 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22102213 |
cagagaccagagtaatgtacatgagaattgatatgcattaaattaaagtatattctaaataagttcatctttttatacctaatttaagacatctgtgtca |
22102312 |
T |
|
| Q |
115 |
attgtcaaattcaattacttctctagttcattcatttataatgcatgaatctgctcgcattagccttatg |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22102313 |
attgtcaaattcaattacttctctagttcattcatttataatgcatgaatctgctggcattagccttatg |
22102382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1665 times since January 2019
Visitors: 6148