View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_34 (Length: 366)
Name: NF0829_low_34
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 12583250 - 12582928
Alignment:
| Q |
1 |
cccaacctgttgccccttcatatcgttatgttgcctcctctgagtttcagcagcacagtgagaacatgtcctccacttccaagttcatgttctagaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12583250 |
cccaacctgttgccccttcatatcgttatgttgcctcctctgagtttcagcagcacagtgagaacatgtcctccacttccaagttcatgttctagaaact |
12583151 |
T |
|
| Q |
101 |
tgttgaaacatttgaagcaatgcaaaagaaggatgttataagacccttcactctaatagctaccactattgatagcccaacatcatattgttttttacga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12583150 |
tgttgaaacatttgaagcaatgcaaaagaaggatgttataagacccttcactctaatagctaccactattgatagcccaacatcatattgttttttacga |
12583051 |
T |
|
| Q |
201 |
attaaagtgtgtttactaacagcataatagtgtgtaccacggtcactgcccaatgcttttcannnnnnngtttctcttatgctccactacaacaaggttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
12583050 |
attaaagtgtgtttactaacagcataatagtgtgtaccacggtcactgcccaatgcttttcacccccccgtttctcttatgctccactacaactaggttc |
12582951 |
T |
|
| Q |
301 |
cactcatattcactcctgtggtg |
323 |
Q |
| |
|
| |||||||||||||| |||||| |
|
|
| T |
12582950 |
cgctcatattcactcccgtggtg |
12582928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 41 - 137
Target Start/End: Complemental strand, 33246050 - 33245954
Alignment:
| Q |
41 |
tgagtttcagcagcacagtgagaacatgtcctccacttccaagttcatgttctagaaacttgttgaaacatttgaagcaatgcaaaagaaggatgtt |
137 |
Q |
| |
|
||||||| ||||||||| ||||| |||| | ||||||||||| | ||||||||||| ||||||| |||||||||||| ||| | |||||||| |||| |
|
|
| T |
33246050 |
tgagtttgagcagcacaatgagaccatgccgtccacttccaaatccatgttctagatacttgttcaaacatttgaaggaataccaaagaagggtgtt |
33245954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 33226447 - 33226496
Alignment:
| Q |
72 |
tccacttccaagttcatgttctagaaacttgttgaaacatttgaagcaat |
121 |
Q |
| |
|
||||||||||| | | |||| |||| |||||||||||||||||||||||| |
|
|
| T |
33226447 |
tccacttccaaatccttgttgtagatacttgttgaaacatttgaagcaat |
33226496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 914 times since January 2019
Visitors: 6134