View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_40 (Length: 361)
Name: NF0829_low_40
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 105 - 332
Target Start/End: Complemental strand, 7336541 - 7336314
Alignment:
| Q |
105 |
ttgttgatgaatatagttgctcagttggatgttgtcttggggaatgtagttggtcagttgaatatcctggacactatcaaagtttctcagttggatgata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336541 |
ttgttgatgaatatagttgctcagttggatgttgtcttggggaatgtagttggtcagttgaatatcctggacactatcaaagtttctcagttggatgata |
7336442 |
T |
|
| Q |
205 |
tgttggtgaaaactattagagctaatttgttagctcagttggatagagtgaagtgtctcaaaagctttttggaggtttatcttgagtcaccaacatcttc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336441 |
tgttggtgaaaactattagagctaatttgttagctcagttggatagagtgaagtgtctcaaaagctttttggaggtttatcttgagtcaccaacatcttc |
7336342 |
T |
|
| Q |
305 |
attttcatcctctcaattatgatcatca |
332 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7336341 |
attttcatcctctcaattatgatcatca |
7336314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 254 - 306
Target Start/End: Complemental strand, 7332310 - 7332258
Alignment:
| Q |
254 |
gaagtgtctcaaaagctttttggaggtttatcttgagtcaccaacatcttcat |
306 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||| |||||||||||| |
|
|
| T |
7332310 |
gaagtgtctcaaaagctttctgaaggtttatctcaagtcaacaacatcttcat |
7332258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 306
Target Start/End: Complemental strand, 7322966 - 7322905
Alignment:
| Q |
245 |
ggatagagtgaagtgtctcaaaagctttttggaggtttatcttgagtcaccaacatcttcat |
306 |
Q |
| |
|
||||||| ||||||||||||||| |||| || || |||||| | ||||| |||||||||||| |
|
|
| T |
7322966 |
ggatagattgaagtgtctcaaaatctttctgaagatttatcgtaagtcagcaacatcttcat |
7322905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2043 times since January 2019
Visitors: 6156