View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_5 (Length: 626)
Name: NF0829_low_5
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 585 - 621
Target Start/End: Original strand, 51805632 - 51805668
Alignment:
| Q |
585 |
atccaagttcttttggaatttgacctgtgaggaaatt |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51805632 |
atccaagttcttttggaatttgacctgtgaggaaatt |
51805668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 129 times since January 2019
Visitors: 6125