View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_53 (Length: 331)
Name: NF0829_low_53
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 36457203 - 36457482
Alignment:
| Q |
1 |
gattgggaggcctaactggtgcagaatttgaatacgctgctgctgtcagcgtctccaaggcaggaccagcctgatactgggtctggaaactagaatctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36457203 |
gattgggaggcctaactggtgcagaatttgaatacgctgctgctgtcagcgtctccaaggcaggaccagcctgatactgggtctggaaactagagtctac |
36457302 |
T |
 |
| Q |
101 |
gcagagattcagctgcaaaagctgatgtagaatgctgtcagatttatatgcaggcgacgagtttagagcagcatatcacctaatttggcgatgtgtcgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
36457303 |
acagagattcagctgcaaaagctgatgtagaatgctgtcagatttatatgcaggcgacgagtttaaagtagcatatcacctaatttggcgatgtgtcgaa |
36457402 |
T |
 |
| Q |
201 |
agtccaggttttcgggtggaagctcctgcagaagaggctgcagtcaatgttgaatttaatcacaagaaacattatgcctg |
280 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457403 |
agtccaggttttcgtgtggaagctcctgcagaagaggctgcagtcaatgttgaatttaatcacaagaaacattatgcctg |
36457482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University