View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_56 (Length: 325)
Name: NF0829_low_56
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 99 - 316
Target Start/End: Original strand, 25495700 - 25495917
Alignment:
| Q |
99 |
ggaatggttttagaaagggaatctgaaatcatcttcgcgctactcaggctagtgtgaagagttaaaaactgatcaattgtatgttgagggttatgttcct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25495700 |
ggaatggttttagaaagggaatctgaaatcatcttcgcgctactcaggctagtgtgaagagttaaaaactgatcaattgtatgttgagggttatgttcct |
25495799 |
T |
 |
| Q |
199 |
tggcagaattacttagctcagcatatacactgcaacaaatataccaaatagtgtcagaaatagcttgagtagtggcagaggaagatgtttaaacatctaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25495800 |
tggcagaattacttagctcagcatatacactgcaacaaatataccaaatagtgtcagaaatagcttgagtagtggcagaggaagatgtttaaacatctaa |
25495899 |
T |
 |
| Q |
299 |
ggtttcaacctaaatata |
316 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
25495900 |
ggtttcaacctaaatata |
25495917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University