View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_60 (Length: 321)
Name: NF0829_low_60
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0829_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 36 - 293
Target Start/End: Original strand, 37789706 - 37789962
Alignment:
Q |
36 |
acttttgtctctagacggctataccttcatttgatagtaa--gataagactcacttgagtgcacacaaaatataagtgaggcgaagtggtaaacgagaga |
133 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
37789706 |
acttttgtctctagacggctataccctcatttgatagtaaaagataagactcacttgactgcacacaaaatataagtgagtcgaagtggtaaacgagaga |
37789805 |
T |
 |
Q |
134 |
aagagatgtaaactatgaagaaactagtgttaaatctaatgttgtagaattgcctcgttggtgcaaccaaatcgtgattattattagatctgactatatc |
233 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
37789806 |
aagagatgtaaactatggagaaactagtgttaaatctaatgttgtagaattgcctcgttggtgcaaccaaatcgtg---attattagatctgactatatc |
37789902 |
T |
 |
Q |
234 |
gtatgtgacagtcgagatttagttgcaccaactacatataagatctaggttcgacttcat |
293 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37789903 |
gtatgtgacagtcgagatttagttgcaccaactacatataagatctaggttcgacttcat |
37789962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University