View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_61 (Length: 320)
Name: NF0829_low_61
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 32726619 - 32726460
Alignment:
| Q |
1 |
taggtttaagagattcttcctttgataccctacctaactcgattgctaaattggagcatttgcgagttctcaaccttatcaataatcgcaaaatcagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726619 |
taggtttaagagattcttcctttgataccctacctaactcgattgctaaattggagcatttgcgagttctcaaccttatcaataatcgcaaaatcagaag |
32726520 |
T |
|
| Q |
101 |
acttccccgatctatttgcaagatttgagactcattggatgcacggagattgaaacattg |
160 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726519 |
acttccccaatctatttgcaagatttgagactcattggatgcacggagattgaaacattg |
32726460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 150 - 299
Target Start/End: Complemental strand, 32726290 - 32726142
Alignment:
| Q |
150 |
ttgaaacattgactattctttcatgtggtagtctagagtccttac-ttacctctttttatttttcctaaattacaggatttgataatttcagactgtgag |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
32726290 |
ttgaaaaattgactattctttcatgtggtagtctagagtccttaccttacctcttt--atttttcctaaattacaggatctgataatttcagactgtcag |
32726193 |
T |
|
| Q |
249 |
atgataaacctatcattatacaataaaagaccaatccaaagattgatgatg |
299 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32726192 |
atgataaacctatcattgtacaataaaagaccaatccaaagattgatgatg |
32726142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 249 times since January 2019
Visitors: 6127