View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0829_low_69 (Length: 298)

Name: NF0829_low_69
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0829_low_69
NF0829_low_69
[»] chr5 (1 HSPs)
chr5 (68-285)||(40113178-40113395)
[»] chr1 (1 HSPs)
chr1 (6-75)||(12583576-12583645)


Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 68 - 285
Target Start/End: Complemental strand, 40113395 - 40113178
Alignment:
68 ttcaaactttagtaggaaacgtagggcatacaattatagtcacaagtggaatagattccaaatggaaacagatttaaagcatgcacactatggatgggaa 167  Q
    |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40113395 ttcaaaatttagtaggaaacgtagggcatataattatagtcacaagtggaatagattccaaatggaaacagatttaaagcatgcacactatggatgggaa 40113296  T
168 acaaatgtgtacaagaatgtttgtcccacacaattgagatttgcatacataccagctgttgtgcaacaaaactcaatagttgaagtagttggatccgatt 267  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40113295 acaaaagtgtacaagaatgtttgtcccacacaattgagatttgcatacataccagctgttgtgcaacaaaactcaatagttgaagtagttggatccgatt 40113196  T
268 cctgtggacaggcaacag 285  Q
    ||||||||||||||||||    
40113195 cctgtggacaggcaacag 40113178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 6 - 75
Target Start/End: Complemental strand, 12583645 - 12583576
Alignment:
6 aataatccataactgtttcccttgttatattgatctatgaacttcttgctacatttgtgctattcaaact 75  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
12583645 aataatccataactgtttcccttgttatattcatctatgaacttcttgctacatttgtgctattcaaact 12583576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1084 times since January 2019
Visitors: 6137