View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_73 (Length: 292)
Name: NF0829_low_73
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 29 - 279
Target Start/End: Complemental strand, 43143060 - 43142801
Alignment:
| Q |
29 |
atatataagtctagactctnnnnnnngtataagtctagattaaaatactcgcaattgcannnnnnnagaatttttctttcgttattgtcttattaacnnn |
128 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
43143060 |
atatataagtctagactctaaaaatagtataagtctagattaaaatactcgcaattgcatttttttagattttttctttcgttattgtcttattaacaaa |
43142961 |
T |
 |
| Q |
129 |
nnnncttgaatatttttagtttataatattaaatatattttagctgacttttacgaatattcagttacacttcacataa---------tacatcttctca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43142960 |
aaaacttgaatatttttagtttataatattaaatatattttagctgacttttactaatattcagttacacttcacataataatacatctacatcttctca |
43142861 |
T |
 |
| Q |
220 |
atcgatcctcttcctgattggcctttggtggatttggagacaccgcaatctcatgtgcct |
279 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142860 |
attgatcctctttctgattggcctttggtggatttggagacaccgcaatctcatgtgcct |
43142801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 245 - 279
Target Start/End: Complemental strand, 8239718 - 8239684
Alignment:
| Q |
245 |
tggtggatttggagacaccgcaatctcatgtgcct |
279 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8239718 |
tggtggatttggagacaccgcaacctcatgtgcct |
8239684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 276
Target Start/End: Complemental strand, 13026175 - 13026138
Alignment:
| Q |
239 |
ggcctttggtggatttggagacaccgcaatctcatgtg |
276 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
13026175 |
ggcctatggtggatttggagacaacgcaatctcatgtg |
13026138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University