View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_75 (Length: 279)
Name: NF0829_low_75
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0829_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 33 - 267
Target Start/End: Original strand, 29942100 - 29942334
Alignment:
Q |
33 |
ggaaccataggtacaatcttgaaaacattcctcaggcttcttcatggttagaattagatggattgttagtttctattgttttataatttgaatttaaatt |
132 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29942100 |
ggaaccataggtacaatcttgaaaacattcctcaggcttcttcatggttagaattagatggattgttagtttctattgttttataatttgaatttaaatt |
29942199 |
T |
 |
Q |
133 |
cttctggatgcaggtgatattgagtccatgccttttattcaagcattaggacatttctcatatagagtaggtgagaatacnnnnnnnatttacaaagttt |
232 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
29942200 |
cttctggatgcaggtgatattgagtccatgccttttattcaagcattaggacatttctcatatagagtaggtgagaatactttttttatttacaaagttt |
29942299 |
T |
 |
Q |
233 |
gccctttggttttaaattgttgtagccgcaacagc |
267 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
29942300 |
gccctttggttttaaattgttgtagccgcaacagc |
29942334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3011 times since January 2019
Visitors: 6168