View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_79 (Length: 271)
Name: NF0829_low_79
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_79 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 43112430 - 43112203
Alignment:
| Q |
16 |
ataaaagaagagaaaattgtaattaacaacacaaaactctattaaccatgaaccatgcataacgatatatttatttaaaggatccattaacataagtccc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43112430 |
ataaaagaagagaaaattgtaattaacaacacaaaactctattaaccatgaaccatgcataacgatatatttatttaaaggatccattaacataagtccc |
43112331 |
T |
 |
| Q |
116 |
gtaaccccgttttatgtgtcgtaagtggaggcctgggacgataaaatttgtacatatgtttatcttgtgctatagcaaattgctcttaaaaggggctact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43112330 |
gtaaccccgttttatgtgtcgtaagtggaggcctgggacgataacatttgtacatatgtttatcttgtgctatagcaaattgctcttaaaaggggctact |
43112231 |
T |
 |
| Q |
216 |
tatgtctgaatttgaggaggtttaatat |
243 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
43112230 |
tatctctgaatttgaggaggtttaatat |
43112203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University