View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_8 (Length: 583)
Name: NF0829_low_8
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0829_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 1e-42; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 17 - 180
Target Start/End: Original strand, 17171605 - 17171766
Alignment:
Q |
17 |
gagatgaagaaaatgacgtctgattacgaggatatacttctgagcatacgattttacaacggggttggttgcattcaatacgaaggttgccaccttcttt |
116 |
Q |
|
|
|||||||||||||||| ||||||||| ||||||| ||||||||||||| || ||||| || ||| ||||||||| |||||||||||| || |||||||| |
|
|
T |
17171605 |
gagatgaagaaaatgaggtctgattatgaggata--cttctgagcataccatcttacagcgaggtaggttgcatttaatacgaaggttaccgccttcttt |
17171702 |
T |
 |
Q |
117 |
ttcgcatttggatggttcaaatcaggaggttttggcattgagttatcctgatattgctggacaa |
180 |
Q |
|
|
|||||||||||||||| |||| | ||||||||||||||||||||||||| ||||| ||||||| |
|
|
T |
17171703 |
gtcgcatttggatggtttaaattaagaggttttggcattgagttatcctggtattgttggacaa |
17171766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 473 - 554
Target Start/End: Original strand, 17172808 - 17172889
Alignment:
Q |
473 |
ataaactattgcactctgatttttgaatttggttttgcactcaaatggacttgcaaattctgctctaatctaatatgactat |
554 |
Q |
|
|
||||||| |||||| |||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
T |
17172808 |
ataaacttttgcacactgaattttgaatttggttttgtactcagatggacttgcaaattctgctctaatctaatatggctat |
17172889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 302 - 464
Target Start/End: Original strand, 17171977 - 17172136
Alignment:
Q |
302 |
tatgcagatttctagtagactgatactcttatggctatccgtttttcttccttttatatccgtttttctagtatcatccttcaagactctcacaccttag |
401 |
Q |
|
|
||||||| || |||||| |||||||||||||| | |||| || ||| || |||| |||| |||| | || |||||||||||||||| | | | ||| |
|
|
T |
17171977 |
tatgcagtttcctagtacactgatactcttatagttatctgtcttttgtcattttgtatctcttttggt-gtttcatccttcaagactcgcgc--catag |
17172073 |
T |
 |
Q |
402 |
tagttgctgcttgatcaaagtttgcgacgattacaacaatgaggctaaagcaattgatgattt |
464 |
Q |
|
|
|||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
17172074 |
tagtcgttgcttgatcaaagtttgcgacaattacaacaatgaggctaaagcaattgatgattt |
17172136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University