View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_84 (Length: 260)
Name: NF0829_low_84
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0829_low_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 90 - 232
Target Start/End: Original strand, 52045006 - 52045148
Alignment:
Q |
90 |
gagtgaatcacaagttagtgcgtgaacttatgatattaataatcctttatactacgttgatagcatttccatttaactggttcattactgttatgttgcg |
189 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||| || |||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
52045006 |
gagtgaatcacaagttagtgcgtgaacttatgatattagtaatcctatatactacattcatagcatttccatttaactgtttcattactgttatgttgcg |
52045105 |
T |
 |
Q |
190 |
tcgtatagaagatatgttgatgccattttgatatcaattcctt |
232 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52045106 |
tcgtatagaagatatgttgatgccattttgatatcaattcctt |
52045148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University