View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_89 (Length: 254)
Name: NF0829_low_89
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_89 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 9 - 254
Target Start/End: Complemental strand, 25496480 - 25496235
Alignment:
| Q |
9 |
agcacagatggcagcaactgaggccatgcaagaggctgctgctgctgacagtttgctacaatgtcttaggtattgactttagatcagattttcagatctt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25496480 |
agcacagatggcagcaactgaggccatgcaagaggctgctgctgctgacagtttgctacaatgtcttaggtattgactttagatcagattttcagatctt |
25496381 |
T |
 |
| Q |
109 |
tgtttcttaatccggttgagattttggactgatcatgtcaagaaatttcaatttcaatttgaaaccaagatatgcattattaataaaggtttttcagtaa |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25496380 |
tgtttcttaatccggttgacattttggactgatcatgtcaagaaatttcaatttcaatttgaaaccaagatatgcattattaataaaggtttttcagtaa |
25496281 |
T |
 |
| Q |
209 |
tttcgttatcaagttgaaacaaatcaccttttgaggatatgcaaaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25496280 |
tttcgttatcaagttgaaacaaatcaccttttgaggatatgcaaaa |
25496235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University