View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0829_low_92 (Length: 251)

Name: NF0829_low_92
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0829_low_92
NF0829_low_92
[»] chr3 (1 HSPs)
chr3 (1-152)||(30400621-30400772)


Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 30400621 - 30400772
Alignment:
1 tgtatgtttgtgaataaattttgctacttggtatggaaatttgttttaaatttttgagggggtaatctgttgttacattctcgtctctatacaattcata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
30400621 tgtatgtttgtgaataaattttgctacttggtatggaaatttgttttaaatttttgagggggtaatctgttgttacattcttgtctctatacaattcata 30400720  T
101 tacttttaattattgagaataaatcttggatttaggtaagaagaccgttagt 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
30400721 tacttttaattattgagaataaatcttggatttaggtaagaagaccgttagt 30400772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 328 times since January 2019
Visitors: 6128