View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_93 (Length: 251)
Name: NF0829_low_93
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 30400645 - 30400487
Alignment:
| Q |
1 |
agcaaaatttattcacaaacatacagaagattggtcattaattaagaaatgaaaatgtgaataacagtgttatttattaccgttatatgaatgactcttc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30400645 |
agcaaaatttattcacaaacatacacaagattggtcattaattaagaaatgaaaatgtgaataacagtgttatttattaccgttatatgaatgactcttc |
30400546 |
T |
 |
| Q |
101 |
ctctcagttttgacccttgagctaatgcagccacccatgccagtgtgttattgatgatg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30400545 |
ctctcagttttgacccttgagctaatgcagccatccatgccagtgtgttattgatgatg |
30400487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 77
Target Start/End: Complemental strand, 30388344 - 30388308
Alignment:
| Q |
41 |
attaagaaatgaaaatgtgaataacagtgttatttat |
77 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
30388344 |
attaagaaaggaaaatgtgaataacaatgttatttat |
30388308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University