View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_97 (Length: 250)
Name: NF0829_low_97
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_97 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 102 - 241
Target Start/End: Complemental strand, 7623530 - 7623391
Alignment:
| Q |
102 |
aaaaatcttcccagaaaattaaattaaaaatatagtattcacatttttctgaaaatacaaactgctgttttgcatcttcaaggagctagtatgtgttttt |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7623530 |
aaaaatcttccgagaaaattaaattaaaaatatagtattcacatttttctgaaaatacaaactgctgttttgcatcttcaaggagctagtatgtgttttt |
7623431 |
T |
|
| Q |
202 |
agtcatgaacaagttttggttatattgacttgagtataat |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7623430 |
agtcatgaacaagttttgcttatattgacttgagtataat |
7623391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 7623794 - 7623691
Alignment:
| Q |
1 |
tcaatttcaacataagttgcactatcaatgtcatttatacgagagtcacatcattttgtaacctgaaaattaatactcattcgaattttatataagagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
7623794 |
tcaatttcaacataagttgcactatcaatgtcatttatacgagagtcacatcattttgtaacctgaaaattaatactcatttgaattttatctaagagaa |
7623695 |
T |
|
| Q |
101 |
taaa |
104 |
Q |
| |
|
|||| |
|
|
| T |
7623694 |
taaa |
7623691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 280 times since January 2019
Visitors: 6127