View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0829_low_98 (Length: 250)
Name: NF0829_low_98
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0829_low_98 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 9463383 - 9463149
Alignment:
| Q |
15 |
tataggacccttaatcaacttctaactgaaaaaaggaacattcagttttagtgtgtatatccgtgcacataatgggagagaatttttcccttaattaaat |
114 |
Q |
| |
|
|||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
9463383 |
tataggacccttaatcaagttataactaaaaaaaggaacattcagttttagtgtgtatatccgtgcaccgaatgagagagaatttttctcttaattaaat |
9463284 |
T |
|
| Q |
115 |
ttaaattaaaataccttacactttataatatgaataatataggatatacatacggttctcaaggagaaaatattatgtcaattaaaattttcagaaacaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
9463283 |
ttaaattaaaataccttacactttataatatgaatattataggatatacatatggttctcaaggagaaaatattttgtctattaaatttttcagaaacaa |
9463184 |
T |
|
| Q |
215 |
tctcaaatatcaaaagcattatataagggaaagtga |
250 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9463183 |
tctc-aatatcaaaagcattatataagggaaagtga |
9463149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 686 times since January 2019
Visitors: 6130