View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_high_10 (Length: 709)
Name: NF0830_high_10
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 425; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 425; E-Value: 0
Query Start/End: Original strand, 1 - 437
Target Start/End: Original strand, 5674824 - 5675260
Alignment:
Q |
1 |
atccaaatccgttaaccttctccaaactgtttgcgatagtctttgctctctcggcgccggcgatgtcgccgcgctttgtgcggaggttggcgacgccggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5674824 |
atccaaatccgttaaccttctccaaactgtttgcgatagtctttgctctctcggcgccggcgatgtcgccgcgctttgtgcggaggttggcgacgccggt |
5674923 |
T |
 |
Q |
101 |
gaaaatggagtgggaaagggagagaaagtttcggaaacggtaataggaggagaatgagagtgattgggagggtgtgatgaagagaattaagaaaaagaag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5674924 |
gaaaatggagtgggaaagggagagaaagtttcggaaacggtaataggaggagaatgagagtgattgggagggtgtgatgaagagaattaagaaaaagaag |
5675023 |
T |
 |
Q |
201 |
atgatgagggttggatttgatcgtacggttgtcatttgatctggagattcaacgctaggagattgcgaaattccactgttgtcgagtgtaaggaaatgtt |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5675024 |
atgatgagggttggatttgatcgtacggttgtcatttgatctggagattcaacgctaggagattgcgaaattccactgttgtcgagtgtaaggaaatgtt |
5675123 |
T |
 |
Q |
301 |
caaggttgtttggattttgcgtatttcggttgggttcgggttattatggcccagaatacatttggttttcttttcttggatcgggttcctattgcaaggt |
400 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||| |
|
|
T |
5675124 |
caaggttgtttggattttgcgtatttcggttgggttcgggttattatggcccagaatacattcggtttcctttttttggatcgggttcctattgcaaggt |
5675223 |
T |
 |
Q |
401 |
caaatccgacaaaattctcctagctttagtactttga |
437 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
5675224 |
caaatccgacaaaattctcctagctttagtactttga |
5675260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 512 - 578
Target Start/End: Original strand, 5675332 - 5675398
Alignment:
Q |
512 |
tgaggaaaattatggttaattaagtttaatctcacgggtatgttatatacacatactttaacattgg |
578 |
Q |
|
|
||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5675332 |
tgagggaaattatggttaattgagtttaatctcacgggtatgttatatacacatactttaacattgg |
5675398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 660 - 697
Target Start/End: Original strand, 5676407 - 5676444
Alignment:
Q |
660 |
tacaacttttccattatggttatcttaggggcaatatt |
697 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
T |
5676407 |
tacaacttttccattatggttaacttaggggcaatatt |
5676444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University