View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_high_114 (Length: 233)
Name: NF0830_high_114
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_high_114 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 1326372 - 1326264
Alignment:
Q |
1 |
aatgtcatcggcaatatagctagtgttgctaaccttgtcactttttgtagccatggatggatttctttgtcaaagctgaagccaattctctgtaagcgtg |
100 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1326372 |
aatgtcatcagcaatatagctagtgttgctaaccttgtcactttttgtagccatggatggatttctttgtcaaagctgaagccaattctctgtaagcgtg |
1326273 |
T |
 |
Q |
101 |
caatccaaa |
109 |
Q |
|
|
||||||||| |
|
|
T |
1326272 |
caatccaaa |
1326264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 4875964 - 4875907
Alignment:
Q |
1 |
aatgtcatcggcaatatagctagtgttgctaaccttgtcactttttgtagccatggat |
58 |
Q |
|
|
||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
T |
4875964 |
aatgtcatcgggaatatagctacggttactaaccttgtcactttttgtagccatggat |
4875907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 44185416 - 44185371
Alignment:
Q |
13 |
aatatagctagtgttgctaaccttgtcactttttgtagccatggat |
58 |
Q |
|
|
|||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
T |
44185416 |
aatatagctacggttactaaccttgtcactttttgtagccatggat |
44185371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 5387556 - 5387503
Alignment:
Q |
1 |
aatgtcatcggcaatatagctagtgttgctaaccttgtcactttttgtagccat |
54 |
Q |
|
|
||||||||||| ||||||| || |||| |||||||||||||||||||||||||| |
|
|
T |
5387556 |
aatgtcatcggaaatatagttactgttactaaccttgtcactttttgtagccat |
5387503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1373 times since January 2019
Visitors: 6140