View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0830_high_124 (Length: 205)

Name: NF0830_high_124
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0830_high_124
NF0830_high_124
[»] chr5 (1 HSPs)
chr5 (1-125)||(16972587-16972711)


Alignment Details
Target: chr5 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 16972587 - 16972711
Alignment:
1 gtattctttctttctctttcttccacatgctctgtcactgttttttctcttaatccaacaatcttttctcactattaataatcacttcttaaatctactt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
16972587 gtattctttctttctctttcttccacatgctctgtcactgttttttctcttaatccaacaatctcttctcactattaataatcacttcttaaatctactt 16972686  T
101 cttcaccattggattcatctcactc 125  Q
    |||||||||||||||| ||||||||    
16972687 cttcaccattggattcttctcactc 16972711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University