View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_high_124 (Length: 205)
Name: NF0830_high_124
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_high_124 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 16972587 - 16972711
Alignment:
Q |
1 |
gtattctttctttctctttcttccacatgctctgtcactgttttttctcttaatccaacaatcttttctcactattaataatcacttcttaaatctactt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
16972587 |
gtattctttctttctctttcttccacatgctctgtcactgttttttctcttaatccaacaatctcttctcactattaataatcacttcttaaatctactt |
16972686 |
T |
 |
Q |
101 |
cttcaccattggattcatctcactc |
125 |
Q |
|
|
|||||||||||||||| |||||||| |
|
|
T |
16972687 |
cttcaccattggattcttctcactc |
16972711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2619 times since January 2019
Visitors: 6164