View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_high_127 (Length: 203)
Name: NF0830_high_127
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_high_127 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 20 - 134
Target Start/End: Original strand, 7609277 - 7609391
Alignment:
| Q |
20 |
agaagggttgtcatgttgtttgtatatttcaaaagttttgggatggtcgtttctttttctcttaagttgttattgtttgatgattgtagagagattttca |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7609277 |
agaagggttgtcatgttgattgtatattttgaaagttttgggatggtcctttctttttctcttaagttgtttttgtttgatgattgtagagagattttca |
7609376 |
T |
|
| Q |
120 |
tccatgtttagttcc |
134 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7609377 |
tccatgtttagttcc |
7609391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 77 - 124
Target Start/End: Original strand, 28559603 - 28559650
Alignment:
| Q |
77 |
tctcttaagttgttattgtttgatgattgtagagagattttcatccat |
124 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
28559603 |
tctcttaagttgttattttttgatgattgtagagggatttccatccat |
28559650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 195
Target Start/End: Original strand, 7609419 - 7609451
Alignment:
| Q |
163 |
catccatgttcacttttcttcacaattcatctc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7609419 |
catccatgttcacttttcttcacaattcatctc |
7609451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3057 times since January 2019
Visitors: 6168