View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_high_26 (Length: 497)
Name: NF0830_high_26
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 90 - 394
Target Start/End: Original strand, 3650613 - 3650920
Alignment:
Q |
90 |
ggagcattttgtttactaaacatcaaatttgattcccaaactatcattttttacttatatatttcatgagctatatgaatatagtaaattgttttcagag |
189 |
Q |
|
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
3650613 |
ggagcattttgtttactaaacatccaatttgattctcaaactatcattttttacttatatatttcatgagctgtatgaatatagtaaattgttttcagag |
3650712 |
T |
 |
Q |
190 |
tattttaaatctactaattagattctagtataagag----gctagactcaagaaatataacgaacaaatatttgaatttcaaatgatagtggtgctcgta |
285 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
T |
3650713 |
tattttaaatctactaattaaattctagtataagaggctagctagactcaagaaatataacgaacaaatatttgaattccaaatgacagtggtgctcgta |
3650812 |
T |
 |
Q |
286 |
tttagagtttgacatatctcgaatatgattatcttgcagagaaagnnnnnnnnnctccaccaatttaatcattcaattacttttaaaatatgagaatgaa |
385 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| ||||| | ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3650813 |
tttagagtttgacatatctcgaatatgattattttgaagagaga-aaaaaaaaactccagcaatttaatcattcaattacttttaaaatatgagaatgaa |
3650911 |
T |
 |
Q |
386 |
agttgaggg |
394 |
Q |
|
|
||||||||| |
|
|
T |
3650912 |
agttgaggg |
3650920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 662 times since January 2019
Visitors: 6130