View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_high_66 (Length: 355)
Name: NF0830_high_66
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_high_66 |
 | |
|
| [»] scaffold0179 (3 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 233 - 326
Target Start/End: Original strand, 894284 - 894377
Alignment:
| Q |
233 |
gcaagagagaagaaataagatataattttaccacgatattgcaatggtagcggaatcaattaaccatgaaagtgctttgttaccaccagggatc |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
894284 |
gcaagagagaagaaataagatataattttaccacgatattgcaatggtagcggaatcaattaaccatgaaagtcatttgttaccaccagggatc |
894377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 101 - 209
Target Start/End: Complemental strand, 6570 - 6462
Alignment:
| Q |
101 |
ttttcagggtgttgagagtggtggattcattgatagagtctataaaaagattagtaagcgaaaaggagaagnnnnnnnnttatcctagaggagaaaggag |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6570 |
ttttgagggtgttgagagtggtggattcattcatagagtctataaaaagattaataagcgaaaaggagaaggaaaaaaaatatcctagaggagaaaggag |
6471 |
T |
|
| Q |
201 |
aggaatgga |
209 |
Q |
| |
|
||| ||||| |
|
|
| T |
6470 |
agggatgga |
6462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 238 - 326
Target Start/End: Complemental strand, 6436 - 6343
Alignment:
| Q |
238 |
agagaagaaataagatataattttaccacgatattgcaatggtagcggaatcaattaaccatgaaagtgc-----tttgttaccaccagggatc |
326 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||| | |||||||||||||| ||||||||||||||||||| |
|
|
| T |
6436 |
agagaagaaataagatataattttaccacaatattgcaatggtagtggaatccaacaaccatgaaagtgctttaatttgttaccaccagggatc |
6343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 6 - 43
Target Start/End: Complemental strand, 6666 - 6629
Alignment:
| Q |
6 |
agcagcacagacacaaattcaccaataatcaaacaccc |
43 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6666 |
agcaacacagacacaaattcaccaataatcaaacaccc |
6629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3017 times since January 2019
Visitors: 6168