View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_high_75 (Length: 336)
Name: NF0830_high_75
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_high_75 |
 | |
|
| [»] scaffold1230 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 33 - 323
Target Start/End: Complemental strand, 25947621 - 25947325
Alignment:
| Q |
33 |
agaactcattgcaattttgaaaggtctt-gagatgtctttgttg------tgaaggctgtatgaatgtggttgttcaatctaattcattcatttctactt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||| | | | || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25947621 |
agaactcattgcaattttgaaaggtctttgagatgtctttgttgcaattttgaaaggtctttgt-tgtggttgttcaatctaattcattcatttctactt |
25947523 |
T |
|
| Q |
126 |
agtttattttggatgattctcnnnnnnnncattctcatgttcctcgtcttcgttgcatccaaaagtatgttgattggtcatggtcaaattctatcatgca |
225 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25947522 |
agtttattttggattattctcttttttttcattctcatgttcctcgtcttcgttgcatccacaagtatgttgattggtcatggtcaaattctatcatgca |
25947423 |
T |
|
| Q |
226 |
tgccttaaagtagagtaattttgtattgattgctatgctacaatgagtcgaattttggtgtcattgcgactcacttgtagttttctttgttgcttttc |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25947422 |
tgccttaaagtagagtaattttgtattgattgctatgctacaatgagtcgaattttggtgtcattgcgactcacttgtagttttctttgttgcttttc |
25947325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1230 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: scaffold1230
Description:
Target: scaffold1230; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 31 - 186
Target Start/End: Complemental strand, 1757 - 1602
Alignment:
| Q |
31 |
gcagaactcattgcaattttgaaaggtcttgagatgtctttgttgtgaaggctgtatgaatgtggttgttcaatctaattcattcatttctacttagttt |
130 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1757 |
gcagaactcattgcaatttagaaaggtcttgagatggctttgttgtgaaggctgtaggaatgtggttgttgaatctaattcattcatttctacttagttt |
1658 |
T |
|
| Q |
131 |
attttggatgattctcnnnnnnnncattctcatgttcctcgtcttcgttgcatcca |
186 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
1657 |
attttggatgatactcttatttttcattctcatgttcctcgtctacgttgcatcca |
1602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3668 times since January 2019
Visitors: 6174