View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_high_79 (Length: 328)
Name: NF0830_high_79
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_high_79 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 3235035 - 3235265
Alignment:
| Q |
1 |
cggacctggattccatgcatttaaaaatcatgcattacacagattagttgatcccttggcagcgatttgagtttgatcgcctcacactatattttgacta |
100 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3235035 |
cggacctggattccctgcgtttaaaaatcatgcattacacagattagttgatccct-gccagcgatttgagtttgatcgcctcacactatattttgacta |
3235133 |
T |
|
| Q |
101 |
aattatctttaaataatcttcactgttgatttgtgaaattgtgatcggacggtcaagatgaataaacacgtcacacatttactgctagaatcaaaatcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3235134 |
aattatctttaaataatcttcactgttgatttgtgaaattgtgatcggacggtcaagatgaataaacacatcacacatttactgctagaatcaaaatcct |
3235233 |
T |
|
| Q |
201 |
gcttcacgactttatgatctcatagtatttgg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3235234 |
gcttcacgactttatgatctcatagtatttgg |
3235265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1756 times since January 2019
Visitors: 6149