View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_high_80 (Length: 321)
Name: NF0830_high_80
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_high_80 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 154 - 243
Target Start/End: Complemental strand, 51456687 - 51456598
Alignment:
| Q |
154 |
ttgttagaatatctctagacttatatgattcaataattttaacggttgatatttgaataagccaaaacagattactctccatgttctaaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51456687 |
ttgttagaatatctctagacttatatgattcaataattttaacggttgagatttgaataagccaaaacagattactctccatgttctaaa |
51456598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University