View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_high_98 (Length: 256)
Name: NF0830_high_98
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_high_98 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 34012366 - 34012593
Alignment:
| Q |
1 |
caagaggaaaatgggctgaagaatggaatagagtatttcttttggtgtgtgcaatggggttatttgtggacccacttttcttctatgcaatctctataag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012366 |
caagaggaaaatgggctgaagaatggaatagagtatttcttttggtgtgtgcaatggggttatttgtggacccacttttcttctatgcaatctctataag |
34012465 |
T |
|
| Q |
101 |
tgacacgtgtatgtgtctatttatagatggttggtttctagttaccgtcaccgttatccgttgcatgacggacatgttacatctctggaatatttggttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012466 |
tgacacgtgtatgtgtctatttatagatggttggtttctagttaccgtcaccgttatccgttgcatgacggacatgttacatctctggaatatttggttg |
34012565 |
T |
|
| Q |
201 |
cagttttatattcataaacataaacgct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34012566 |
cagttttatattcataaacataaacgct |
34012593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1553 times since January 2019
Visitors: 6145