View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_106 (Length: 285)
Name: NF0830_low_106
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_106 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 37 - 285
Target Start/End: Complemental strand, 23225788 - 23225540
Alignment:
| Q |
37 |
taaagtgtgattacttgaagcagacattagttagaaactagttgaataactagttgttagttatctaactgtttactaggagttagttatgatatgcaac |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23225788 |
taaagtgtgattacttgaagcagacattagttagaaactagttgaataactagttgttagttatctaactgtttactaggagttagttatgatatgcaac |
23225689 |
T |
|
| Q |
137 |
tacccttagttagagatacaaaggatcgatactagtataaataattctatcactgcagtgtataaattagatttgtgaatgcaactattttcatcttagt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23225688 |
tacccttagttagagatacaaaggatcgatactagtataaataattctatcactgcagtgtataaattagatttgtgaatgcaactattttcatcttagt |
23225589 |
T |
|
| Q |
237 |
ctctatacttgaaaatctatctatcttctattctttccttcatggagtt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23225588 |
ctctatacttgaaaatctatctatcttccattctttccttcatggagtt |
23225540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 632 times since January 2019
Visitors: 6130