View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_107 (Length: 285)
Name: NF0830_low_107
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_107 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 59 - 186
Target Start/End: Original strand, 43560506 - 43560633
Alignment:
| Q |
59 |
atttcttcttgtggggactgtataccctccctattctacatacataatgcataatgtatgtgacacattcacatggactttgttacctctcattatctca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43560506 |
atttcttcttgtggggactgtataccctccctattctacatacataatgcataatgtatgtgacacattcacatggactttgttacctctcattatctca |
43560605 |
T |
|
| Q |
159 |
ttattttaaaatgaatgccaagtttcac |
186 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43560606 |
ttattttaaaatgaatgccaagtttcac |
43560633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 210 - 254
Target Start/End: Original strand, 43560654 - 43560698
Alignment:
| Q |
210 |
aactacattgtatataggaaacttgatctgtgattttcttctcac |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43560654 |
aactacattgtatataggaaacttgatctgtgattttcttctcac |
43560698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1686 times since January 2019
Visitors: 6149