View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_113 (Length: 265)
Name: NF0830_low_113
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_low_113 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 28 - 250
Target Start/End: Original strand, 30953060 - 30953282
Alignment:
Q |
28 |
cagaaattggggttatgggtcaaaatttctcaatgatgcaaaattgaaattgagagggagagaacatacagtataagaattggggctatgggtcaaattt |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30953060 |
cagaaattggggttatgggtcaaaatttctcaatgatgcaaaattgaaattgagagggagagaacatacagtataagaattggggctatgggtcaaattt |
30953159 |
T |
 |
Q |
128 |
tcgtaatgatgcaaaactgaaattgaagcaaagtagtacacaagaaataaagtatgagaatttatgcgttgttgttattgtttgttgtctcaatgaaatt |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30953160 |
tcgtaatgatgcaaaactgaaattgaagcaaagtagtacacaagaaataaagtatgagaatttatgcgttgttgttattgtttgttgtctcaatgaaatt |
30953259 |
T |
 |
Q |
228 |
tttatgagttttattcttctctg |
250 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
30953260 |
tttatgagttttattcttctctg |
30953282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University