View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_114 (Length: 261)
Name: NF0830_low_114
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_114 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 232
Target Start/End: Original strand, 44812891 - 44813108
Alignment:
| Q |
16 |
attgatatgggataaaacacctgcatgtaccnnnnnnnnctttctttctgtcctatatcaagattagatgcatcaactatttaaacaacagcgacttagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44812891 |
attgatatgggataaaacacctgcatgtaccttttttttctttctttctgtcctatatcaagattagatgcatcaactatttaaacaacaacgacttagt |
44812990 |
T |
 |
| Q |
116 |
attattttatttgattttattataaatgaatagggattaatttggttctag-aatcaatggcttcttcccgcttcctctcctccttccgctctttcatgg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44812991 |
attattttatttgattttattataaatgaatagggattaatttggttctagaaatcaatggcttcttcccgcttcctctcctccttccgctctttcatgg |
44813090 |
T |
 |
| Q |
215 |
ctgccataccccatccac |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44813091 |
ctgccataccccatccac |
44813108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University