View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_121 (Length: 252)
Name: NF0830_low_121
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_121 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 34012209 - 34011959
Alignment:
| Q |
1 |
cgatgtcatcatcagtggtgttgtagtaatagtgttgcatgtttgaattaaaacttgagtgatgttgatcgggggccatggatggaggatatatgatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012209 |
cgatgtcatcatcagtggtgttgtagtaatagtgttgcatgtttgaattaaaacttgagtgatgttgatcgggggccatggatggaggatatatgatcag |
34012110 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnn--------atgaagaaaaaatgaagtggttagttagttatattaagggaaatgagatgcatgcaaagggtaagagtgaggtgggaag |
192 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012109 |
agagagagagagagagagagaatgaagaaaaaattgagtggttagttagttatattaagggaaatgagatgcatgcaaagggtaagagtgaggtgggaag |
34012010 |
T |
 |
| Q |
193 |
agagaacatgaaaggaaactgatggatggtagctagcttttggagtataat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012009 |
agagaacatgaaaggaaactgatggatggtagctagcttttggagtataat |
34011959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University