View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_125 (Length: 251)
Name: NF0830_low_125
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_125 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 16972865 - 16973111
Alignment:
| Q |
1 |
ttcaattttttcatggtatttttcctatgtaggaatttttgttattagtcttacatcaaaatgggttattttctacttgtttgaaaatgggtatatataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16972865 |
ttcaattttttcatggtatttttcctatgtaggaatttttgtcattagtcttacatcaaaatgggttattttctacttgtttgaaaatgggtatatataa |
16972964 |
T |
|
| Q |
101 |
tattaggctatttcatgaaaatttag---nnnnnnnnngttatataaattttatggttggttgtttgatttgctttgaacaaatagtatataattgatgg |
197 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16972965 |
tattaggctatttcatgaaaatttagttttttttttttgttatgtaaattttatggttggttgtttgatttgctttgaacaaatagtatataattgatgg |
16973064 |
T |
|
| Q |
198 |
aaatttgtttatgtttattgcagattttgatgcttgagttctgtgct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16973065 |
aaatttgtttatgtttattgcagattttgatgcttgagttctgtgct |
16973111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2507 times since January 2019
Visitors: 6164